viernes, 17 de mayo de 2013

Quiénes somos, de dónde venimos...San Pedro de Abanto, siglo XVII

Este artículo puede considerarse una continuación del anteriormente publicado "Y tú ¿De quién eres?. San Pedro de Abanto, siglo XVI". Tirando del archivo parroquial, proseguiremos con nuestro análisis de los grupos familiares, esta vez con los datos del siglo XVII, mucho más abundantes y completos.

Campanario derruido de la iglesia vieja de San Pedro de Abanto

Creo que todos, más o menos, tenemos curiosidad por conocer nuestros orígenes. Es natural, yo diría casi biológico. Sin embargo que quien se meta en esto no espere necesariamente grandes glorias familiares. Es un pasatiempo que satisface la curiosidad personal y que permite relacionar la historia de la familia con la Historia con mayúsculas. Cuando uno se interna en el mundo de la genealogía, se puede llegar a encontrar muchas sorpresas. Los amantes de los pedigrees puros, se verán decepcionados cuando descubran que varios de sus antepasados se separan de la línea "noble" o "racial". Por otra parte, los devotos del mestizaje absoluto (que los hay), también se decepcionarán cuando descubran que tampoco son tan mestizos ni cosmopolitas como les gustaría y que sus familias proceden de media docena de comarcas no muy separadas geográficamente y más bien poco exóticas. Esto último es más común de lo que se cree.

Por eso he titulado, esta entrada "¿Quienes somos? ¿De dónde venimos?...", parafraseando a la gran banda viguesa Siniestro Total, regocijo lírico de nuestra mocedad ochentera. Todo esto nos lleva inevitablemente a hacer un repaso de ciertos conceptos biológicos de la trasmisión de la herencia genética por lo que haré una introducción de ........

Genética para genealogistas

Ya nos habíamos dado cuenta hace tiempo de que cada uno es de su padre y de su madre y que encima nos parecemos a ellos. Algo nos han debido trasmitir. Esto es común a todos los seres vivos, vamos, que las gallinas, engendran gallinas, las cabras, cabras y las lechugas lechugas. El refranero ya lo dice: "De tal palo tal astilla" o "De padres gatos hijos michines" o "Quien a los suyos se parece, honra merece". Pero cómo se trasmite esto de padres a hijos ¿Va en la sangre?. ¿Dónde y como está esta información? ¿Qué son los genes? ¿Dónde están?, ¿A qué huelen? ¿Cómo suenan?.  La verdad es que la ciencia ha llegado ha descubrir las leyes de la transmisión genética así que para explicar todo esto no se me ocurre nada mejor que contar la historia de cómo se descubrió.

A mediados del siglo XIX, un monje austriaco llamado Gregor Mendel, se le ocurrió hacer experimentos cruzando plantas de guisantes y registrando como las plantas "hijas" heredaban el aspecto de los padres. Lo hizo con guisantes, que era lo que tenía más a mano y se preocupó de observar cosas como el color de las semillas o si tenían aspecto rugoso. Mendel anotó cuidadosamente, los resultados de sus cruzamientos y llegó a unas conclusiones que hoy en día son perfectamente válidas y que explican por ejemplo como se transmiten los grupos sanguíneos humanos (Grupo A, B, 0 ó AB y el factor RH). Mendel expuso sus investigaciones en una sociedad local y sus trabajos no tuvieron gran repercusión en aquel momento. Además el buen Gregor, murió de una nefritis crónica sin saber en realidad el por qué de las leyes que había descubierto. Hoy en día se le considera el padre de la genética. ¿quién le iba a decir a él?.

Gregor Mendel y sus guisantes.
Ahí quedó la cosa, pero los biólogos no descansaban. Conocían las leyes de Mendel, pero el verdadero reto, la verdadera incógnita era descubrir el "material", la "sustancia" del que estaba hecha la herencia biológica. Y, por supuesto, en que parte del organismo se encontraba.

En 1869, el suizo Friedrich Miescher, estaba trabajando en su laboratorio intentando conocer la composición química de apósitos manchados de pus. La afición de este buen hombre por tan sucio material, venía motivada por el hecho curioso de que el pus está compuesto principalmente de glóbulos blancos, es decir es una preparación muy concentrada de estas células. En sus extracciones con alcohol, sales y otros potingues, se dio cuenta de que aparecía un precipitado gelatinoso (llamamos precipitado a una especie de "poso" que queda después de algunas reacciones químicas). Como vio que este precipitado aparecía de los núcleos de las células lo llamó NUCLEÍNA. No tenía ni idea de lo que era. Vio que tenía una composición peculiar en fósforo y nitrógeno y que era diferente a otra sustancia obtenida hasta la fecha.

Miescher, su sórdido laboratorio de la Universidad de Tubinga, y el tubo de ensayo donde obtuvo la nucleína.

En 1944 Oswald Avery, Colin MacLeod y Maclyn Mc Cartney, trabajaban con bacterias. Las bacterias son el verdadero "ganado" del biólogo. Las bacterias son seres vivos bastante sencillos, de una sola célula. Puedes conseguir millones de células a placer, reproducirlas, crecerlas... Todo ello en un tubo de ensayo y en cuestión de horas. Bien, pues, estos biólogos trabajaron con unas bacterias llamadas neumococos. Había unos neumococos que podían producir neumonía en ratones y otros que no. Vieron cómo "algo" que tenían los neumococos "malos" podía transformar a los "buenos" en "malos", aunque los "malos" estuvieran muertos. después de probar varias partes de los neumococos comprobaron que se trataba de la "nucleína" de Mescher o del "principio transformante" del que años antes, había hablado Frederick Griffith en 1928. A esta sustancia la analizaron y llegaron a la conclusión de que era  " una forma viscosa de ácido desoxirribonucleico altamente polimerizado".

Avery, McLeod y McCartney y el experimento que hicieron.

Así se llegó a descubrir de que estaban hechos los genes...de ÁCIDO DESOXIRRIBONUCLEICO, o conocido más popularmente como ADN, molécula hoy en día famosa for las pruebas forenses y de paternidad.

Pero ahí no acababa la cosa, se sabía que había "algo", con cierta composición química que era la base de la trasmisión hereditaria. Pero ¿cómo era y que aspecto tenía?  y lo más importante ¿cómo funcionaba?.

En 1953, James Watson y Francis Crick, mediante técnicas de rayos X, lograron "ver" la molécula y lo que vieron fue una molécula, una especie de fibra con forma de escalera de caracol, lo que ellos llamaron la "doble hélice". Los "peldaños" de esta escalera eran únicamente de cuatro tipos diferentes, como si fueran de cuatro colores (en realidad se llaman BASES NITROGENADAS). Así pues, simplificando, los genes, son eso. Una "fibra" de ADN con los eslabones, los "peldaños" diferentes. Esta es una forma ingeniosa de almacenar información. Las cuatro bases nitrogenadas (los peldaños) las llamamos Adenina (A), Guanina (G), Timina (T) y Citosina (C). Cada peldaño está compuesto de una pareja diferente pero la Adenina siempre se empareja con la Timina (AT) y la Guanina con la Citosina (GC). Así, en este lenguaje, están escritos los genes. Por ejemplo un gen sería algo así:

ATCGGACGACGTATGACCTAGCTAGCAGTA
TAGCCTGCTGCATACTGGATCGATCGTCAT

Por esto digo que los biólogos somos de letras.

Cada gen tiene estas letras en diferente orden y esto supone una información diferente.

Watson y Crick, el ADN y Wilkins

Llegados a este punto, no me puedo resistir a recordar a uno de esos personajes de la ciencia que han quedado injustamente olvidados. Watson y Crick recibieron el premio Nobel por su descubrimiento junto con Maurice Wilkins. Wilkins era el jefe del laboratorio donde se obtuvieron las imágenes de rayos X que posibilitaron el descubrimiento. Estas imágenes (la famosa fotografía 51) fueron obtenidas en realidad por Rosalind Franklin, una de sus investigadoras. Ella, al ver las imágenes ya interpretó la verdadera estructura del ADN, por lo que creo que merece también el reconocimiento de su descubrimiento. La comisión del premio Nobel, no tuvo la oportunidad de dudar si concederle a ella el premio, ya que poco antes Franklin falleció de un cáncer de ovario, se cree que por la exposición a las radiaciones en su laboratorio (los premios Nobel sólo se conceden a personas vivas). Qué dura era la vida del investigador secundario y más si eras mujer (sigue siéndolo).

Rosalind Franklin y la auténtica fotografía 51, con la firma de la propia Rosalind (observese la marca de óxido del clip). La fotografía muestra la sombra del ADN al ser atravesado por un haz de rayos X. Los expertos en esta técnica son capaces de deducir cual es la forma de las moléculas por la imagen que forman.

Volviendo al lío. Ya hemos visto que en la molécula de ADN, dependiendo del orden de las bases o peldaños se almacena diferente información. Pero ¿cómo demonios se interpreta esa información? ¿qué es lo que hace que una molécula de este tipo se convierta en todo un ser vivo, con sus células, sus manos, su cara y sus miserias?.

El ADN, no son más que los "planos", las instrucciones. Es como si resumiéramos un edificio en un libro y allí están sus planos, las instrucciones de cómo funcionan los sistemas de calefacción, iluminación.... La gente que lo tiene que ocupar. Los planos  y las instrucciones son necesarios para construír el edificio, de igual manera los genes gobiernan el desarrollo fetal de "construcción" de nuestro organismo. Pero los planos y las instrucciones también son necesarios para el normal funcionamiento del edificio ya construído o para hacer reparaciones ante algún daño. De igual manera los genes gobiernan nuestro organismo en el día a día, para cuplir las funciones vitales o para reparar "desperfectos", o para defenderse de "ataques".

Pero de alguna manera se deben interpretar esos planos, y aquí entran en juego Severo Ochoa y Marshall Nirenberg. En los años 50 y 60 del siglo XX ambos contribuyeron al descubrimiento la forma en que los organismos vivos interpretaban esas secuencias. Resumiendo y simplificando mucho: El ADN se traduce a unas sustancias llamadas PROTEÍNAS. Las proteínas son los verdaderos "ladrillos" de los organismos vivos. Algunas son los "obreros" que cumplen las funciones. De tal forma que un organismo vivo o una célula, para hacer y ser cosas diferentes lo que tiene que hacer es producir, sintetizar, diferentes proteínas.

Las proteínas, son como cadenas compuestas de 20 tipos de eslabones llamados AMINOÁCIDOS. Unas son más largas y otras son más cortas. Las uñas y el pelo, por ejemplo, están compuestas de una proteína llamada queratina. La clara del huevo es una proteína llamada albúmina. Cuando se convierte el queso en cuajada hay una proteína (el cuajo) que corta en pedazos a otra proteína de la leche (la caseína) y hace que ya no se pueda disolver y se "cuaje". Y así seguir con miles de funciones. Todas las proteínas son diferentes, pero están todas compuestas por 20 tipos de "eslabones" o aminoácidos, lo único que las diferencia es cuantos y cuales aminoácidos o "eslabones" tengan.

Pues bien, lo que Severo Ochoa encontró fue la "clave" del mensaje. El final de la historia es que cada tres "peldaños" (bases nitrogenadas) del ADN, se corresponden a un "eslabón" o a un aminoácido. La "clave" se la denominó CÓDIGO GENÉTICO. Y en relación a este asunto hay un hecho impresionante. Todos los seres vivos del planeta utilizan  y utilizaron la misma clave o código genético, desde el elefante hasta la más miserable bacteria. Esto permite que en un laboratorio podamos "meter" a una bacteria una "instrucción" de otro organismo y la bacteria interpretará esa instrucción. Esto es la INGENIERÍA GENÉTICA y es muy útil para la producción industrial de ciertos medicamentos y vacunas. Un GEN es cada parte del ADN donde está la información para producir una proteína. En una larga fibra de ADN puede haber muchos genes, miles de ellos, unos detrás de otros, disponibles para cuando sean necesarios.

Ochoa y Nirenberg no trabajaron juntos, de hecho hubo una especie de carrera para ver quién descubría primero el código genético. La clave final y el mecanismo fueron descubieros en una secuencia de avances realizados por ambos científicos. Por ello recibieron ambos el Premio Nobel. Ochoa en 1955 y Nirenberg en 1968.

Curioso, Severo Ochoa era asturiano, nacido en Luarca. En el Km 503 de la N-634, con lo que la genética queda conectada a través de nuestra ruta transcantábrica.

Ochoa, el código genético y Nirenberg

Este sólo es el relato de los hechos más relevantes, omitiendo, que no olvidando a otros muchos investigadores que han aportado luz sobre este tema.

Pero ¿dónde y cómo está el ADN en nuestro cuerpo y cómo lo trasmitimos a nuestros hijos?. Todos los seres vivos están compuestos de CÉLULAS. Las células son como una especie de ladrillos con vida propia. En nuestro cuerpo el hígado está compuesto de células de hígado (se llaman hepatocitos) que son diferentes a las células del cerebro (neuronas) o a las de la piel (queratinocitos). Cada tipo de célula tiene su función y sabe lo que tiene que hacer. Es capaz de "leer" la parte del ADN que necesita e interpretarla para ser una buena chica, disciplinada con su función. Cuando crecemos de niños a adultos  cada vez vamos teniendo más células (y diferentes)  y cuando somos mayores y sufrimos alguna herida o daño las células se dividen y multiplican para reparar la herida. Además normalmente, nuestro organismo repone las células "viejas" y las sustituye por unas "nuevas". Todos estos procesos tiene en común el hecho de que una célula es capaz de dividirse en dos y formar dos células idénticas. La clave de esta división es que el ADN de la célula "madre" se duplica con toda su información y pasa una de las dos copias a cada una de las células "hijas".

El ADN, está en un lugar de las células que se llama NÚCLEO, una especie de vesícula o "burbuja" que todas las células llevan dentro. Y está en TODAS las células del organismo (con algunas honrosas excepciones). Está TODA la información tanto en las células del hígado, como en las de la piel, como en las del cerebro. Está TODA la información, haga falta o no. Por ejemplo, en una célula del hígado están las "instrucciones" de funcionamiento de una célula del cerebro, sólo que no se usan. Esto parece un desperdicio, pero les viene muy bien a los forenses que son capaces de identificar a una persona "leyendo" el ADN y comparando el que se encuentra en la base de un pelo (escena del crimen) con el de un sospechoso.

Dentro del núcleo de cada célula está el ADN, o sea los genes. Los humanos tenemos unos 20.500 genes (al conjunto de genes se le llama GENOMA). Ya se puede suponer que para todos esos genes hace falta una fibra de ADN kilométrica. Pero claro, una célula es muy pequeña, microscópica. Tiene entre 10 y 100 micras, es decir, en 1 milímetro pueden caber 100 células humanas puestas en fila. Y el núcleo es aun más pequeño. La clave es que la fibra de ADN está SUPERENRROLLADA, sobre sí misma. Recordemos que pasaba con el cable del teléfono que siempre se daba vueltas y se quedaba en nada. Pues algo así le pasa al ADN. Está tan enrrollado que cabe en el núcleo.

Pero no tenemos una única fibra de ADN. En realidad el ADN humanoestá errollado en 46 "ovillos" o paquetes. Estos ovillos, se llaman CROMOSOMAS. Es como si todo nuestro ADN estuviera empaquetado en 46 maletas. Cada célula humana tiene 46 cromosomas, ni uno más ni uno menos. Tener una alteración en este número supone un serio problema de salud (por ejemplo en el síndrome de Down, que se tiene 47). Otras especies tienen diferente número de cromosomas. Y esta es una de las buenas razones para que sea tan difícil que se críen "híbridos" entre diferentes especies. Sólo hay excepciones muy excepcionales como los mulos o ciertos mixtos de pájaros.

Superenrrollamiento del ADN y su empaquetamiento en cromosomas en el núcleo celular

Decía antes que todos somos de nuestro padre y de nuestra madre. los 46 cromosomas, en realidad son 23 parejas. 23 de ellos los hemos recibido de nuestro padre y 23 de nuestra madre. Son como 23 "maletitas" en las que los genes (o más bien sus copias) han viajado a través de los tiempos.

Imagen auténtica de las 23 parejas de cromosomas extraídas de una célula humana. Las parejas están numeradas del 1 al 22 y después está la pareja que aparece en la imágen como XY, de la que hablaremos más tarde. Como se puede ver tienen forma de X y tienen tamaños desiguales porque tienen  diferentes genes.

Hagamos un símil, suponemos que los genes son trajes o vestidos. En nuestro armario tenemos trajes para pasear, para hacer deporte, para ir a una fiesta, pijamas, trajes de baño...de la misma forma que tenemos genes para el color de los ojos, el tamaño de nuestra nariz, o la predisposición a padecer alguna enfermedad. Bien pues de cada "traje" tenemos dos modelos, uno nos lo ha dejado en herencia nuestro padre y otro nuestra madre. En el espermatozoide de nuestro padre había 23 "maletitas" (cromosomas) con un modelo para cada traje. Y en el óvulo de nuestra madre había otras 23 "maletitas" (cromosomas) con  otro modelo para cada traje. Así al unirse en el momento de la concepción la célula resultante tendrá los 46 cromosomas, con dos modelos de traje para cada ocasión. A lo largo de nuestra vida, en muchos casos, nos pondremos los dos trajes y en otros casos sólo uno, dependiendo de que le resulte más "atractivo" (dominante) al organismo. En cualquier caso, incluso el traje que no nos hayamos puesto nunca,  lo podemos transmitir a nuestros hijos (esta es la razón por la que algunas características se "saltan" una o varias generaciones).

Los genes del padre y de la madre son pues, en general equivalentes, por eso da lo mismo apellidarse Iturrondobeitia Gómez que Gómez Iturrondobeitia. El primer apellido, se ha transmitido por línea paterna, eso es, lo tenía el padre del padre del padre....., por razones de costumbre. Y sólo tiene de especial eso. Genéticamente es poco relevante. El segundo apellido se ha transmitido siempre por línea paterna a excepción de la última generación, que se ha transmitido por línea materna. Nuestro último apellido, el que la mayoría de nosotros no conocemos, se ha trasmitido sólo por línea materna, pero es tan relevante genéticamente como el primero. El orden de los apellidos, primando el del padre, se ha hecho por convención social y no tiene ninguna base genética, ni el orden representa importancia, ni, como veremos más adelante, la representación genética es proporcional a cada apellido.

Claro, tenemos un padre y una madre, cuatro abuelos, ocho bisabuelos, 16 tatarabuelos, 34 cuartos abuelos y así sucesivamente. En el corto espacio de 13 generaciones (como mucho habríamos llegado al siglo XVI), resulta que tenemos más de 8000 antepasados (excluyendo consanguinidades, que ocurren inevitablemente cuando nos remontamos muy antiguo ya que no hubo tanta población en el planeta).

Naturalmente somos al menos el cóctel genético del revoltijo hereditario de estas 8000 personas (y sus respectivos ascendientes, claro). Pero ¿cómo? ¿en qué proporción?. Uno podría pensar que si somos la mitad de nuestro padre y de nuestra madre, lógicamente ellos serían la mitad de cada uno de sus padres. Entonces, nosotros tendríamos que tener una cuarta parte de cada uno de nuestros abuelos, una octava de nuestros bisabuelos y así sucesivamente. Bien pues esto es FALSO. y ahora explicaré por qué.

Si el lector se ha fijado antes, he dicho que en los espermatozoides y en los ovulos hay 23 cromosomas. esos "paquetes" u "ovillos" en los que están empaquetados los genes en forma de ADN. Pero, ¿no habíamos dicho que todas las células tiene  46 cromosomas?. Bien, pues esta es la honrosa excepción que toda ley biológica debe tener. Los espermatozoides y los óvulos tienen la MITAD de cromosomas, para que cuando se unan en la fecundación el embrión resultante tenga los 46 de rigor. Aquí va haber que empezar a poner dos rombos.

Y aquí está la clave de la transmisión genética. Los espermatozoides se forman en los testículos del padre y los óvulos en los ovarios de la madre. Las células de los testículos y de los ovarios tienen como cada hijo de vecino 46 cromosomas, pero a partir de ellas se forman los espermatozoides y los óvulos con 23. ¿Cómo lo hacen?.

Cuando se forma el espermatozoide o el óvulo es como si se preparasen para un viaje y tuvieran que llevar los "trajes" de los que hablamos (los genes) Pero sólo UN modelo de cada traje, porque el otro modelo lo pondrá la otra parte. Así, cada uno de los espermatozoides y los óvulos. Preparan una "maleta" (cromosoma) nueva, y la llenan con UN modelo de cada traje, escogido al azar entre los DOS que tenía de su padre y de su madre. Por eso, un modelo del abuelo no se trasmitirá al nieto.

Considerando la totalidad de los genes (la totalidad de los trajes) el resultado de todo esto es que todos los espermatozoides  y todos los óvulos son DIFERENTES entre sí, porque para tipo de traje han escogido un modelo diferente, bien el del padre o bien el de la madre. Por eso, los hermanos, aunque procedan del mismo padre y de la misma madre son diferentes entre sí (a excepción de los gemelos verdaderos, que son verdaderos "clones" naturales).

Como curiosidad, los espermatozoides se forman en los testículos  de manera continua y abundante a partir de la pubertad durante toda la vida. Sin embargo, los óvulos, se forman en el ovario durante el crecimiento embrionario. Por lo tanto, si el lector tiene una hija, por niña que sea, que sepa que en sus pequeños ovarios ya están formados los óvulos que podrán dar lugar a sus nietos. Estos óvulos, se madurarán uno a uno, cada mes, en cada menstruación, desde la pubertad hasta la menopausia. Bueno, a veces se maduran más, y podríamos tener mellizos.

Por lo tanto podemos decir que somos mitad de nuestro padre y mitad de nuestra madre. Pero no tenemos porqué ser cuarta parte (25%) de cada uno de nuestros  cuatro abuelos. Igual somos 10%-20%-60%-10% y nuestro hermano unas proporciones diferentes. Lo mismo con los bisabuelos. Una persona con las anteriores proporciones, podría tener las siguientes proporciones de sus ocho bisabuelos. 2%-8%-15%-40%-20%-6%-4%, y su hermano otra diferente. Incluso, avanzando en las generaciones, podría darse el caso de que la proporción de un antepasado sea insignificante.

Ejemplo de la distribución desigual de los genes a través de las generaciones. Así puede ser la historia. Supongamos que tenemos sólo 4 genes (cuadrado, círculo, triángulo y estrella). Abuelo Agapito, tenía sus genes (en rojo, dos copias de cada). En sus espermatozoides puso sus genes, igual que la abuela Eulalia que tenía sus genes (azules) y en su óvulo los puso igualmente. Lo mismo hicieron el abuelo (verde) y la abuela Petronila (amarillo). Así mamá Crescencia tenía la mitad de su padre y de su madre, mitad azul y mitad rojo. Lo mismo le pasó a papá Homobono que tenía mitad de la abuela Petronila (amarillo) y la otra mitad del abuelo Ordoño (verde). Pero cuando mamá Crescencia produjo sus óvulos, algunos de ellos se llevaron tres genes del abuelo Agapito y sólo uno de la abuela Eulalia. Por otra parte cuando papá Homobono produjo sus espermatozoides algunos de ellos se llevaron tres genes de la abuela Petronila y sólo uno del abuelo Ordoño. Así Rufina (Rufy, para los amigos) tenía la mitad de los genes de sus padres pero no tenía la cuarta parte de sus abuelos, de hecho, el abuelo Ordoño aunque le dio su primer apellido sólo tenía un gen de los ocho. Rufina, en sus ovarios tiene óvulos bien diferentes entre sí, algunos de ellos no tienen nada del abuelo Ordoño ni de la abuela Eulalia. Si extrapolamos esto a muchas generaciones y a los más de 24000 genes tenemos una idea de lo complejo de la situación.

En resumen, que podemos estar seguros de que los "trajes" (genes) que tenemos, los hemos heredado de nuestros más remotos antepasados, pero no podemos asegurar que hemos heredado unos genes de un antepasado determinado. Salvo que encontremos su tumba, y le hagamos el análisis genético correspondiente. Y encontrar la tumba de un antepasado de hace 500 años, sólo está al alcance de reyes y familias muy relevantes, pero quien sabe, entre los 8000 ó mas igual encontramos alguna sorpresa.....

Pero, como ya he dicho anteriormente, toda regla biológica tiene su honrosa excepción. Hay un pequeño grupo de genes que se transmite exclusivamente por línea materna y otro que se transmite por línea paterna. Empezaremos explicando esta última.

Hemos dicho que tenemos 46 cromosomas; 23 pares de "maletas". De cada pareja, una procede del padre y otra de la madre. Una de esas parejas es "especial". Si eres mujer, parece una pareja normal, son dos maletas con los mismos modelos, Estos cromosomas se llaman X, y por lo tanto la pareja será XX. Pero si eres hombre una de los cromosomas es igual que el de la mujer (X) pero el otro es más pequeño, se llama cromosoma Y, por lo tanto un varón será XY. El cromosoma Y, aunque es más pequeño, en uno de sus "compartimentos" tiene algunos genes que no pueden estar en el cromosoma X. Esto es muy importante por lo siguiente.

Si eres mujer todos los óvulos que produzcas tendrán cromosoma X, no tienes otra opción, y los genes que vayan en ese cromosoma procederán indistintamente e imprevisiblemente de tu padre o de tu madre.

Pero si eres hombre, la mitad de tus espermatozoides llevarán un cromosoma X, pero la otra mitad llevarán un cromosoma Y. Este cromosoma tiene unos genes que son "exclusivos" masculinos, se llaman (GENES HOLÁNDRICOS). Son como unos "trajes" que sólo tienen un modelo y que sólo pueden ir en ese compartimento de la maleta. Al formarse el espermatozoide no ha tenido que elegir entre el modelo de traje del padre y de la madre. Sólo tiene para elegir el del padre. En esa "maleta" o cromosoma también hay genes "normales".

Si un espermatozoide con cromosoma X fecunda a un óvulo (que invariablemente llevará un cromosoma X) el bebé resultante será XX, mujer.Si un espermatozoide con cromosoma X fecunda un óvulo (que invariablemente llevará un cromosoma X) el bebé resultante será XY, varón. Y llevará intactos los genes de esa pequeña porción, procedente del padre. Así que podemos decir que nuestro primer apellido representa esos genes que se nos han legado por el padre del padre del padre.....de nuestro padre. Hablamos naturalmente de nuestro padre biológico, infidelidades aparte.

Determinación del sexo en la fecundación.

Como se puede ver, lo que decide el sexo de un niño es el el espermatozoide, por lo tanto el varón. Así que los reproches esos de "esta mujer no me da niñas" o "niños" no tienen ningún fundamento. Sí que puede haber condiciones que hagan que uno u otro tipo de espermatozoide "llegue" antes, pero lo normal es que tengan la misma probabilidad de llegar y si uno hace un sencillo cálculo encuentra aquí la explicación de que nazcan tantos niños como niñas.

Por otra parte, igual que existen este tipo de genes, existen otros que se transmiten únicamente por línea materna, pero cómo lo hacen es bien diferente y es consecuencia de cómo se produce la fecundación entre el espermatozoide y el óvulo. Y también consecuencia de otra excepción.

Antes habíamos dicho que el ADN estaba en el núcleo. La mayoría y el más importante si. Pero existe otro lugar dentro de las células en el que existe ADN. Estos lugares se llaman MITOCONDRIAS. Las mitocondrias son como unas vesículas, más pequeñas que el núcleo que le sirven a la célula para respirar. Se cree que si hay ADN allí es porque las mitocondrias son realmente bacterias que se "resguardaron" en el interior de una célula más grande y esta asociación se mantuvo en la evolución porque era beneficiosa por ambas partes.

Célula "diseccionada" en la que se ve cómo las mitocondrias (en rojo) están fuera del núcleo y se trasmiten directamente a través del óvulo, y con ellas sus genes, tal y como se explica en el esquema de la derecha.

Bien, pues sabido esto, si observamos el óvulo de una mujer, es una célula completa (y por cierto, bastante grande, 100 micras), con su núcleo, mitocondrias etc. Sin embargo un espermatozoide es móvil y pequeño. Es como una "bala" y en la fecundación sólo aporta sus cromosomas. Resultado: Todas las mitocondrias del embrión proceden del óvulo y por lo tanto de la madre. Es decir, nuestras mitocondrias, y por tanto su ADN es una réplica exacta del de nuestra madre, de la madre de nuestra madre, de su madre y así sucesivamente. Si somos mujeres tendremos la oportunidad de transmitírsela a nuestros hijos. Si somos hombres, nuestra descendencia no las recibirá jamás (salvo que tengamos hijos con una prima nuestra, con la que compartamos línea materna). En el caso de nuestro ejemplo anterior, Rufina habrá recibido directamente sus genes mitocondriales de Eulalia (que le da su cuarto apellido), a través de su madre Crescencia. Papá Homobono, habrá recibido sus genes mitocondriales de la abuela Petronila pero no los habrá podido transmitir a Rufina porque solo "envió" un espermatozoide.

Y aquí acabo esta "introducción", a sabiendas de que me he pasado y me he enrollado demasiado. Si el lector, todavía tiene fuerzas o ha tenido el valor de aguantar hasta aquí, a continuación hablaré de una vez por todas de las familias de nuestro pueblo.

SAN PEDRO DE ABANTO. SIGLO XVII

Como ya he comentado anteriormente, este es un artículo continuación de uno anterior, en el que echamos un vistazo a los registros parroquiales del siglo XVI. Ahora continuamos con el XVII (1601-1700). Es este el siglo en el que se publica "Don Quijote de la Mancha" en el que viven Quevedo y Lope de Vega. En el que reinan los Austrias Felipe II, Felipe IV y el último, Carlos II. El imperio español está en su máximo apogeo, pero en él hay grandes contrastes entre glorias militares y miseria.

El concejo de San Pedro de Abanto es un núcleo rural, bastante poblado en comparación con otros de Bizkaia. Todavía quedaban casi 200 años para que se empezasen a explotar masivamente las minas de hierro. Fue el siglo XVII en el norte peninsular una época de estancamiento demográfico. Sobre todo en los núcleos urbanos. La gente pobló el campo, aunque el balance general fue de apenas crecimiento de población.

Pero no todo iban a ser penas, a mediados de siglo una planta traída de América, el maíz, se estableció en el campo cantábrico y sustituyó al trigo como cereal dominante.

Puerta sur, y parte de la tapia del antiguo cementerio

He intentado, como en el anterior artículo identificar los núcleos familiares a partir de las partidas de bautismo y matrimonio. Para empezar, algunas observaciones de carácter general acerca de cómo se ha realizado este trabajo.

MÉTODO


Se han utilizado los registros de la Parroquia de san Pedro de Abanto que están disponibles en la base de datos del Archivo Historico Eclesiastico de Bizkaia, entre los años 1601 y 1700 ambos inclusive. Se observa que existen registros de bautismos y matrimonios durante todo este periodo. Sin embargo, los registros de defunciones sólo aparecen a partir de 1641. Se han recopilado, listado y ordenado todos los individuos bautizados y se han identificado individuos familiarmente relacionados a partir de la base de datos de matrimonios


Se ha  intentado identificar las familias en base a los siguientes criterios:

* Grupo de 2 o más bautizados con el primer y segundo apellido iguales e hijos de  padre y madre del mismo nombre, con diferencia máxima de 20 años, entre el hermano más mayor y el más joven. Hemos considerado en estos casos familias se haya encontrado o no el registro del matrimonio de sus padres

* Un bautizado aislado siempre que se haya encontrado el registro del matrimonio de sus padres.

Siempre que se haya verificado una relación que trascienda de la familia nuclear se ha confeccionado el árbol genealógico. Por ejemplo, si se ha visto que está registrado el matrimonio de alguno de los hijos se ha utilizado para confeccionar un árbol de parentesco entre dos familias.

Hay que ser consciente de que un estudio de este tipo va a tener las siguientes limitaciones:

1. Los registros siguen sin ser exhaustivos. Es decir, muy probablemente no se bautizarían todos los que nacen, en especial niños que fallecen al poco de nacer. Si que existe un gran crecimiento de registros respecto al siglo anterior. De hecho, es en este siglo cuando se empiezan a registrar las defunciones en esta parroquia. Sin embargo, es en este siglo cuando las autoridades eclesiásticas empezaban a velar por que estos registros se llevasen a cabo. De hecho en los libros parroquiales aparecen indicadas varias inspecciones del "Visitador" que era una especie de inspector que enviaba el obispo para verificar este y otros aspectos del funcionamiento de la parroquia. Ya era hora de vigilar el cumplimiento de las disposiciones del Concilio de Trento de 1563.

2. De nuevo tenemos la duda si las familias lo eran en el sentido nuclear (padre-madre-hijos) o en sentido extenso, con allegados como parientes o simples acogidos como sirvientes. Por una parte, el número de bautizados por familia es relativamente bajo, perfectamente compatible con una familia nuclear poco numerosa. Pero por otra parte, los apellidos se repiten muchísimo y a veces da la impresión de que se han tomado del lugar o el caserío donde se habitaba.

3. Los registros de bautismo, se hicieron mayoritariamente consignando los dos apellidos del bautizado, pero no se han detallado los dos apellidos de los padres. En el registro de matrimonios la inscripción de los contrayentes con dos apellidos es rara y en el registro de defunciones es casi nula. Esto hace sospechar que los clérigos ponían especial celo en el registro del bautismo y mucho menor en el del matrimonio y la defunción. Esto ha hecho difícil relacionar familias ya que dada la repetición de los apellidos y la poca originalidad de los nombres (bueno, en eso no hemos cambiado), resulta imposible en muchos casos identificar inequívocamente un individuo en la fases de bautismo-matrimonio-defunción.

4. Habría relaciones familiares que trascenderían la parroquia, especialmente en los concejos vecinos del área de Encartaciones. Esto no se ha considerado, pero es posible la aportación poblacional así como la "emigración" a otras poblaciones del entorno.

En resumen, no podemos asegurar que están todos los que eran, pero si que eran todos los que están, y todo ello nos puede llevar a sacar o al menos sospechar algunas conclusiones sobre cómo vivian nuestros antiguos vecinos.

BAUTIZOS


Entre los años 1601 y 1700, se registraron en la parroquia de San Pedro de Abanto un total de 982 bautizos, repartidos en 536 varones, 443 mujeres y 3 que no se ha podido determinar el género. Como se puede ver hay un pequeño sesgo a favor de los varones lo que da que pensar que el registro no es totalmente completo. Lo que si vemos es que en comparación con los 216 bautizos que se registraron en el siglo anterior hay un aumento considerable. Esto no quiere decir necesariamente que esto se deba a un aumento de la población sino a un aumento de los registros. Vamos a intentar relacionar las oscilaciones que observamos en este gráfico con las tendencias de población que se han podido conocer por otros estudios. En concreto por el artículo de José Manuel Cifuentes Pazos y Ángel Larrea Beobide: "La población vizcaína en el siglo XVII: Tendencias dominantes". (revista Vasconia, nº 29, año 1999). Estos autores hacen un análisis de la evolución de la población  en este periodo, en base a las fogeraciones y los vecindarios, que eran recuentos con finalidades fiscales en los que aparecían sólo parte de los habitantes. Así, en 1635, en Abanto y Ciérvana se contaban más de 300 vecinos (por cierto, uno de los más poblados de Bizkaia en aquel entonces), pero esto en realidad significaba que había más habitantes. Los autores para una población vizcaína de 15.000 vecinos (año 1703) le calculan unos 76.000 habitantes. Aplicando este coeficiente, para nuestro municipio estaríamos hablando de al menos 1.480 habitantes para los actuales municipios de Abanto y Ciérvana y Zierbena.

Cruz labrada en la arenisca sobre la puerta norte. Se observan los restos de un antiguo pórtico.


En nuestro gráfico se observan aproximadamente los cuatro periodos que los autores del artículo anterior describen:

Evolución de los bautizados en San Pedro de Abanto. Siglo XVII


1601-1608A mediados del siglo anterior (XVI) hubo una epidemia de peste, que a buen seguro nos dejó bastante "tocados". Se sabe que en la primera década del siglo aún se hacían sentir los efectos de la crisis de finales del siglo anterior. La media de bautismos en este periodo es de 1,53, como mucho 3 bautismos por año, algo comparable a la última década del siglo XVI.


1609-1625: Periodo de leve recuperación, con una media de 9,8 bautismos/año. En Bizkaia, este periodo está descrito hasta mediados de los años 30.

1626-1660: Periodo con altibajos, con una media de 5 bautizos/año. Sin embargo se alternan años con 16 bautizos (1618) con varios años. con ningún bautizo. En este periodo se asentó el cultivo del maíz, sin embargo se sufrieron sequías entre 1629 y 1635 y malas cosechas en 1630 y 1631. Esto último podría estar reflejado en nuestro pueblo ya que entre 1630 y 1631 sólo se bautizó un niño. Otros periodos en los que no se bautizó ningún niño fueron 1644-1646, y 1650-1651.

1661-1691. Periodo de recuperación. Se registra un aumento brusco con una media de 17 bautismos por año. Es el periodo de máxima explotación del maíz. Esto está también descrito para toda Bizkaia (1666-1693) en este periodo, y es un reflejo de cómo la situación agrícola influía en la población y como en concreto San Pedro de Abanto se veía igualmente influido, por lo que podemos suponer que la base de su economía era la agricultura.

1691-1700. La última década del siglo supuso un descenso del número de bautismos. Se trata de un periodo de malas cosechas y en lo económico un periodo de oscilaciones muy bruscas de los precios. Todo ello anticipando la crisis de principios del XVIII. La media de bautismos en este periodo cae considerablemente, hasta 6 bautismos/año.

En resumen, aunque el número de bautizados, en este siglo es superior al anterior, ello podría deberse a una mayor diligencia por parte de los párrocos en el registro. Pero dentro del siglo, las oscilaciones son reflejo de las coyunturas generales de Bizkaia, con pocos años de diferencia.

 Y ahora algunas curiosidades sobre nuestros vecinos de hace 400 años.

Para las mujeres, el nombre más común es MARÍA con 169 bautizos (un 39% del total de las mujeres) aquí la clasificación con los nombres más populares de nuestras convecinas de hace 4 siglos.

  • Puesto 1. Con 169 bautizos (39%): MARÍA
  • Puesto 2. Con 46 bautizos (11%): FRANCISCA
  • Puesto 3. Con 35 bautizos (8%): CATHALINA
  • Puesto 4. Con 17 bautizos (3,9%): MADALENA
  • Puesto 5. Con 16 bautizos (3,7%): JOANA/JUANA
  • Puesto 6. Con 15 bautizos (3,4%): ANGELA
  • Puesto 7. Con 13 bautizos (3,0%): JOSEPHA
  • Puesto 8. Con 10 bautizos (2,5%): ANTONIA
  • Puesto 9. Con 9 bautizos (2,1%): ANA, AGUSTINA, AGUEDA
  • Puesto 10. Con 8 bautizos (1,8%): MANUELA
  • Puesto 11. Con 7 bautizos (1,6%): YNES, LUZIA, TRINIDAD
  • Puesto 12. Con 6 bautizos (1,4%): MARTA, MATHEA
  • Puesto 13. Con 4 bautizos (0,9%): YSABEL, PAULA, CONCEÇION
  • Puesto 14. Con 3 bautizos (0,7%): SANTOS, MICAELA, JAZINTA, TOMASA
  • Puesto 15. Con 2 bautizos (0,5%): CASILDA, FELIPA, LORENÇA, VENTURA, CLARA
Otros nombres de mujer que aparecen con 1 bautismo (0,2%) son: TEODORA, CECILIA, BALTASARA, GEORJA, PETRONILA, MARZELA, SEVASTIANA, JULIANA, EULALIA, APARIÇIA, BASILIA, PASCUALA, TERESA

Marcas de canteros

Para los varones, el nombre más común es JOAN o JUAN con 92 bautizos (un 18% del total de los varones) aquí la clasificación con los nombres más populares de nuestros convecinos de hace 4 siglos.

  • Puesto 1. Con 92 bautizos (18%): JOAN/JUAN
  • Puesto 2. Con 77 bautizos (15%): PEDRO
  • Puesto 3. Con 37 bautizos (7,2%): FRANCISCO
  • Puesto 4. Con 31 bautizos (6,1%): JOSEPH/JOSEPHE
  • Puesto 5. Con 25 bautizos (4,9%): DOMINGO
  • Puesto 6. Con 20 bautizos (3,9%): MARTÍN, ANDRÉS
  • Puesto 7. Con 18 bautizos (3,5%): ANTONIO
  • Puesto 8. Con 13 bautizos (2,5%): SIMÓN
  • Puesto 9. Con 12 bautizos (2,3%): DIEGO
  • Puesto 10. Con 11 bautizos (2,1%): BERNABÉ, BARTOLOMÉ
  • Puesto 11. Con 10 bautizos (2%): SANTIAGO
  • Puesto 12. Con 9 bautizos (1,8%): VICENTE, MANUEL
  • Puesto 13. Con 8 bautizos (1,6%): MATEO, LUCAS
  • Puesto 14. Con 7 bautizos (1,4%): MIGUEL, COSME, THOMAS
  • Puesto 15. Con 6 bautizos (1,2%): COLÁS/NICOLÁS, GEORGE, AGUSTÍN
  • Puesto 16. Con 4 bautizos (0,8%): GREGORIO, ROQUE, JULIÁN, LORENÇO, MARCOS, GABRIEL, RAMÓN, FELIPE
  • Puesto 17. Con 3 bautizos (0,6%): PASQUAL, BENTURA
  • Puesto 18. Con 2 bautizos (0,4%): PAULO, BENITO, BERNARDO, CARLOS, CHRISTOVAL
Otros nombres de varón que aparecen con 1 bautismo (0,2%) son: RAFAEL, BASTIAN, DIONISIO, GASPAR, MAURICIO, SANTOS, ANTOLÍN, DAMIÁN, ESTÉBAN, YÑIGO, FERNANDO, YSIDRO, PATRIZIO, SILBESTRO, GERMÁN.

En ambos casos, hay algo que no ha cambiado. Los primeros puestos de la lista acaparan la mayoría de los nombres. Esto era y es cuestión de modas. Curiosamente, se ha visto, que en San Pedro de Abanto, durante las primeras décadas del siglo se puso especialmente de moda el nombre Francisco o Francisca.

Partos múltiples

Un detalle que se observa durante este siglo, es la aparición de los primeros registros de partos múltiples del pueblo. La aparición de un parto múltiple ha sido siempre un hecho extraordinario. El hecho más extraordinario lo encontramos en un parto de TRILLIZOS. Las hermanas CATALINA, MARÍA y SANTOS, bautizadas el 23 de septiembre de 1673, hijos de JUAN CALVO y MARÍA PUCHETA. Esto debió ser un acontecimiento y un verdadero riesgo para la madre y los niños. Si hoy en día estos partos son siempre de riesgo, imaginemos hace 400 años. No se ha encontrado registro de defunción que coincida con la madre o alguno de los niños. Aunque, como luego veremos, es díficil en esta época encontrar esta correspondencia.

Además se han encontrado 5 partos de MELLIZOS:

JUAN y LUCÍA, hijos de JUAN BARRERA y MARÍA ANDRÉS PUCHETA, bautizados el 21de noviembre de  1638
FRANCISCA y CATALINA, hijas de FRANCISCO SANFUENTES y MARÍA CAMPOS, bautizadas el 8 de marzo de 1655
MADALENA y DOMINGO, hijos de PEDRO CALBO y MARICRUZ PUCHETA, bautizados el 16 de julio de1662
AGUEDA y JUAN, hijos de JULIÁN LAYA y MARÍA PUCHETA, bautizados el 11 de mayo de 1678
ANTONIA y JOAN, hijos de JOSEPHE CALVO y CATHALINA SAN MARTÍN, bautizados el 3 de septiembre de 1683



MATRIMONIOS
Entre 1601 y 1700 se registraron en la parroquia de San Pedro de Abanto, un total de 277 matrimonios. En la inmensa mayoría de los casos se registraban los contrayentes con sólo un apellido. Como veremos más adelante, estos matrimonios se celebraban con la mujer embarazada de su primer hijo o con uno o varios hijos ya nacidos. (esto se vé al cotejar la fecha de la boda con la fecha del bautizo del hijo mayor, cuando esto ha sido posible).

En un total de 28  casos (12 hombres y 16 mujeres) se ha podido localizar la fecha de bautismo de alguno de los contrayentes, de esta manera se ha podido ver la edad a la cual se casaban. La edad media del matrimonio era 22,5 años para los hombres y 23,9 años para las mujeres. No quiere decir esto que no cohabitasen antes, pero debía ser poco antes del matrimonio ya que como he comentado antes, hemos encontrado bastantes casos en los que se casaban esperando el primer hijo o con el primer hijo nacido.

Detalle de la puerta sur

La evolución a lo largo del siglo reproduce, como cabría esperar, las fases de los bautismos, corroborando la estrecha relación entre ambos registros.




DEFUNCIONES


Estos son los primeros registros de defunciones de la Parroquia de San Pedro de Abanto en toda su historia. Aparecen a partir de 1641 y se registran un total de 464 defunciones repartidos en 211 varones y 253 mujeres. Se registran una media de 7,7 defunciones anuales. Se  anotaba el nombre del difunto con un apellido, por lo que estos registros no nos han servido para obtener otros datos tales como edad al morir.

Adosado al campanario aun se conservan los restos del antiguo cementerio. La tapia y una vieja sepultura. y un pequeño prado que pudo albergar las tumbas en el pasado. Este lugar sirvió de parapeto a las tropas carlistas en la sangrienta batalla de Somorrostro.

La evolución a lo largo del siglo no presenta grandes altibajos, más bien reflejo de las oscilaciones en población. Parece que no hubo grandes epidemias y/o catástrofes ya que los años de mayor mortandad fueron, 1694, con 21 registros, 1666 con 19 registros y 1665 con 16 registros.




APELLIDOS


Durante el siglo XVI, en San Pedro de Abanto, aparecen 185 apellidos, 45 de ellos ya han aparecido en el siglo anterior. Aquí está la relación completa de apellidos nuevos que aparecen por décadas. En  gris se indican los apellidos que ya aparecen en el siglo anterior. Insisto, son apellidos NUEVOS, por ejemplo, el apellido Pucheta ya aparecía en el siglo anterior (XVI) y aparece en la primera década del XVII. En las décadas posteriores también hay bautizados o matrimonios con este apellido, pero no lo he detallado para resaltar el aporte de nuevos apellidos al siglo.


1600-1610: TELLITU, CUETO, SANLLORENTE, CAMPOS, ESCARZA, UGARTE, VILLAR, LLOSA, MENDOZA, CALBO DE MONTAÑO, PUCHETA, ALLENDE, CALLEJA, MURRIETA, CORTAZAR, SANFUENTES, REVILLA, ROSALLES, CHABARRI, SANMARTÍN, SALZEDO, SIERRA, FLOR, MOSTOLES, QUINTANAS, SARACHAGA, LARREA, MONTAÑO, PEDREGAL, BARCO, BARRERA, TOBES, LUÇANDO, YBAÑEZ DE ATUAÇU, ESTRIBILLO.

1611-1620: LLANAS, AVELLANEDO, PACHÓN, HEROS, ACEBAL, BODEGA, ARCO, POBEÑA, CAGIGO, ERA, CALLERA, CAPETILLO, ELGUERO, MUENTE, MUSQUES, BALLICOQUI, TORRES, BAÑALES, GARAY, COTARRO, SALCEDILLO, CORTES, RIO, FONTUSSO, OYANCAS, OTAÑES, PAUL, COSCOJALES, GALDAMES, MEILLU, ALZEDO, AGUIRRE, LABARCENA, LABALUGA, TORRE, LOPEZ DE LA PUENTE, CERRO, JAUREGUI, MERCADO, PANDO.

1621-1630: CASAL, LOREDO, CHURIAGA, CERIBIAN, URQUIOLA, YRIBARREN, BOLLOQUI, AMEÇA.

1631-1640: BELEZ, URIOSTE, QUADRA, MONTE, HORMILLAS, CAMPA LANÇA, SANTELIZES, PUCHETA SOPEÑA, PUCHETA CANPA, MURGA, NOCEDAL, LONGAR

1641-1650: CUAÇO, CASTRO, SOBRADO, CLARA, BALPARDA, BALLIBIAN, ESCARÇAGA, ANTÓN, MEDRANO, CARDON, BETANÇOS, TRENTO, MARROQUIN DE SANPELAYO.

1651-1660: TELLECHE, COLAS, OYOS

1661-1670: URTETIGUI, PEÑUÑURI, CASTAÑO, TRUÇIOS, REA, HESPAÑA, SOPEÑA, MANÇANAL, GARAMA, MORAZA, HIGAREDA, MERINO, SAEZ DE MURRIETA, SANTIBANIS, MIÑAO, TUEROS, PORRAS, SAN JINES

1671-1680: SAN CHRISTOBAL, DIAS DE ALLENDE, HERNANDEZ, MENCHACA, LARRAZABAL, MATANZA, VASTETIGUI, PUCHETA VARVON, ALONSO DE EVIADERO, ALONSO DE LLANAS, POZO, LAGUNO, RICARDO, LAYA, GUSTAMANTE, ALZEDO, SOTA, LLANES, MERRO, FERNANDEZ, UGUARI, ARRAZABAL, LATEJERA, MARCOLETA, TELLITU SALDORTÚN, CARDON DE LA PUENTE.

1681-1690: SAEZ DE PUCHETA, GARZIA DEL VALLE, JIMENEZ, BASON, SALDAMANDO, URCULO, PUERTO, CARRERAS, ARZE, PEÑA BLANCA, PUCHETA PERUZA, AGUERO, PEDRERA, LARA, LLARENA, OTONAS, LATORRE, ARROYOS

1691-1700: CHALAZ, MACHÍN, ESTRADA, ZULAYCA, CASAS, MAGEN, PUCHETA REYNA, YBARA

En la primera década, predominan los apellidos (y supuestamente las familias) que poblaban la localidad en el siglo anterior. El gran aporte de apellidos nuevos, se da principalmente en dos oleadas: Una primera oleada en el periodo 1611-1620 y otra en el periodo 1661-1690. Esto coincide con dos momentos de aumento de bautismos: el de la primera década, recuperación de la crisis de finales del XVI y el de la segunda mitad del siglo hasta la crisis de los años 90 (explotación del maíz). Una explicación lógica de primeras sería que muchas de estas familias "nuevas", aunque ya existían en el siglo anterior, no figuraban en los registros de entonces por parecer más incompletos. Pero no hay que descartar cierta inmigración procedente del interior de las Encartaciones (muchos de ellos de Galdames) a juzgar por los apellidos. A partir de aquí no podemos mas que teorizar sobre si ocurrió tal inmigración y por qué pudo deberse. Podrían ser las minas, las ferrerías o el transporte de mineral. Aunque pudo haber razones agrícolas tales como una mayor superficie cultivable y fértil por las condiciones climáticas mas suaves debidas a la cercanía de la costa. El hecho agrícola en esta centuria parece tener más peso en la economía del pueblo que el hecho minero. Todo esto son sólo hipótesis.

De los 185 apellidos 53 de ellos corresponden a topónimos actuales. Es decir, corresponden a nombres de lugares que existen actualmente y que no están muy lejos. Aquí queda la duda de si el lugar dio nombre a la familia o la familia al lugar. Posiblemente ambas cosas. La identidad entre el apellido y el caserío es algo tradicional en el campo vasco así que no nos debe sorprender. Así, es difícil saber si el barrio de Pucheta se llama así porque vivía la familia Pucheta o si los que vivieron allí se apellidaron automáticamente Pucheta. Es posible que ocurrieran ambas cosas. Se ha hecho una localización sobre el mapa de los lugares actuales denominados como estos apellidos y así podemos tener una idea del entorno geográfico de influencia y/o origen de estos grupos familiares.


Ver Apellidos Abanto Siglo XVII en un mapa más grande

Además aparecen apellidos que coinciden con topónimos lugares mucho más lejanos como Mostoles o Betanços, este último apellido muy extendido en las Encartaciones y que aparece en los primeros registros de bautismos.

Por cierto, como curiosidad. También podemos hacer un "ranking" de los apellidos: El apellido que más aparece es PUCHETA (con sus variantes ortográficas tales como Puchetta) que lo tienen 283 de los bautizados en primero o segundo lugar (el 28,8%) , seguido de LLANAS (11,5%), MURRIETA (10,2%)  SANFUENTES (o Sanjuentes) (7,4%), y SAN MARTÍN (6,4%).

Finalmente decir que muchos apellidos del siglo anterior no vuelven a aparecer en este. Algunos de ellos seguramente pasan transformados (podría por ejemplo ser el caso de Frías Otañes a Otañes ó Gómez del  Casal a Casal). Pero otros desaparecen definitivamente.



FAMILIAS

He intentado agrupar todos los bautizados en familias con los criterios que he comentado anteriormente: grupos de dos o mas bautizados con los mismos apellidos, el nombre de los padres iguales y que no se diferencien en más de 20 años en su fecha de nacimiento. O bien, personas individuales que se haya encontrado el matrimonio de sus padres en la parroquia.

Se han encontrado un total de 241 familias, que supone clasificar a un 77 % de todos los bautizados. Ello no quiere decir que el resto no perteneciesen a familias de la localidad. Simplemente se han omitido por no tener seguridad. El listado completo se muestra en la tabla que aparece en este enlace (me ha parecido más práctico no insertarla directamente en el texto, ya que es enorme).

A partir de las fechas de nacimiento y matrimonio de estas familias, se han podido hacer unos sencillos cálculos que nos pueden dar algo de información sobre cómo se formaban las familias y cual era su dinámica reproductiva.

En primer lugar, vemos que el grupo familiar mayor fueron los MENCHACA-MEDRANO con 11 hijos bautizados entre 1672 y 1692. Durante el siglo XVII, se bautizó una media de 3 niños por familia. Podemos observar la evolución de este dato a lo largo del siglo.

No se observan grandes variaciones. Si que hay un ligero aumento a partir de los años 50 y una caida en los 90. Esto es reflejo de las fases que se han descrito cuando analizamos la gráfica de bautismos. La conclusión sería que las oscilaciones que vimos afectaron escasamente al tamaño de las familias

Si consideramos el periodo de tiempo entre el primero y último bautismo de cada familia podemos descubrir el periodo reproductivo de una pareja y cuantos hijos se tenían en este periodo. Vemos que el periodo reproductivo medio era de 8,5 años. También podemos observar la evolución de este dato a lo largo del siglo, representándolo frente al año del primer hijo

De la evolución de este dato lo mismo podemos decir. El periodo reproductivo sería similar, con independencia de las coyunturas económicas. Tanto esto como lo anterior, podría explicarse por la ausencia de condiciones "catastroficas" tales como epidemias o guerras, que habrían alterado estas gráficas.

Hay que tener en cuenta que estos análisis, nos pueden dar una visión parcial. Insisto en que el registro puede no ser completo, en especial en lo que se refiere a los párvulos, es decir, a los niños que morían al de poco de nacer. Por eso, todos estos datos nos dan idea de unos números MÍNIMOS. Es decir, que sabemos que al menos, estas familias tenían estos hijos y durante este tiempo. Podrían haber tenido más, pero menos no.

En esta recopilación de datos, en muchos casos hemos podido conocer a la vez la fecha del matrimonio de los padres y de bautismo del primer hijo. Esto nos puede dar una idea de cuantas parejas se casaban esperando el primer hijo o incluso con uno o varios hijos ya nacidos. Sorprendentemente el número de datos es abundante. Se han encontrado ambas fechas en 108 casos y de ellos en 34 (31%) el matrimonio es posterior al nacimiento del primer hijo o celebrado con menos de 7 meses de antelación al primer nacimiento. Aunque a buen seguro que existieron numerosos hijos "naturales", registrarlos como tales era poco frecuente. De hecho sólo se ha encontrado en un caso.


GENEALOGIAS

Como en el artículo anterior, se ha intentado identificar aquellas relaciones que trascendieron supuestamente la familia "nuclear", intentando hacer árboles genealógicos haciendo seguimiento de los emparentamientos y la evolución de las familias a través de más de una generación.

A pesar del aumento de registros respecto al siglo anterior, la repetición de los apellidos hace muy dificil trazar a los individuos a lo largo del siglo. Esto se ha conseguido en un número muy limitado de casos. Es muy posible que existan más ya, que la repetición de los apellidos sugiere mayores relaciones familiares, pero estos son los que he podido verificar con razonable seguridad (los parentescos no confirmados pero muy probables se detallan en rojo, se trata de aquellas personas que por coincidencia de apellidos, año de nacimiento, la relación e identidad es muy probable):

Emparentamiento de tres familias en la primera mitad del XVII, los VALLE-REVILLA, LLANAS-PACHON y HEROS BALPARDA,y sus descendencias




Hermanos MURRIETA CAXIGO, sus matrimonios y descendencia.
Emparentamiento de los ABELLANEDO MELLO y los PEDREGAL BARCO
Primera generación BALPARDA-MUENTE y segunda generación PUCHETA-BALPARDA
Familia ALLENDE CORTAZAR, emparentados con MURRIETA LLOSA

Triple emparentamient entre los BARCO-MURRIETA, SAN MARTIN ABELLANEDO y MUENTE MURRIETA
Dos generaciones, los PACHON MUENTE y GARAMA PACHON

Dos generaciones, LARREA-MONTAÑO y LARREA LARREA

Emparentamiento entre los PUENTE-CAPETILLO y SANJUENTES BALLE

Emparentamiento PUCHETA-REVILLA y PACHON MURRIETA. Tercera generación: PUCHETA-PACHON

Posible emparentamiento entre los PEDREGAL-LLANAS y PUCHETTA PUCHETTA

Cuatro generaciones: COTARRO LLANAS, SAN MARTIN COTARRO y SAN MARTIN ARZE

Tres familias independientes con sus emparentamientos en segunda generación.

Matrimonios de los hermanos LLANAS QUINTANA

Primera generacion, SANJUENTES FONTUSSO y segunda LLANAS SANJUENTES.
Primera generacion, REVILLA MURRIETA y segunda MENDOÇA REVILLA.

Dos familias y dos generaciones

Dos familias y tres generaciones

Familia MERINO MURRIETA

Tres generaciones del apellido PUCHETA

Emparentamiento entre los PUCHETA LLANAS y los CALVO-PUCHETA, con trillizos incluidos.

Posivble doble matrimonio de Pedro Pucheta Cotarro. Un posible caso de primeras y segundas nupcias.

Matrimonios de los hermanos MUENTE MUENTE

Tres generaciones del apellido ACHIGA

Esta es la genealogia más extendida a lo largo del tiempo que se ha podido determinar: 5 generaciones.

Emparentamieento entre los LLANAS BARCO y los VALLE MURRIETA

Familia SANJUENTES BALLE

Emparentamiento entre los PUCHETA SANLLORENTE y los MUENTE BARRERA

Familia COTARRO BALLICOQUI

Doble matrimonio de Santiago Urtetigui


Bien, pues aquí llego al final, esperando haber cumplido el objetivo de sacar del anonimato a tantas personas que formaron parte de nuestro pasado. 

Viejo camino de llegada a la iglesia, protegido por las encinas. La llamada "cuesta de los muertos", por las comitivas fúnebres que subían por aquí.

Ahora que ya vamos sabiendo quienes somos y de donde venimos, nos queda saber a donde vamos, que es lo complicado....







10 comentarios:

  1. Jo Armando te lo juro me lo he leído de principio a fin, de verdad que me han encantado y te voy a decir más me ha gustado más que el que hiciste como primera parte. Esta todomuy bien documentado y lo que más me ha llamado la atención es que lo has explicado hablandote mal de puta madre. Me he enterado mejor con tus explicaciones en comparación las que nos daban en el colegio o instituto, eres un fenomeno macho. Haber si algún día y tienes tiempo y ganas y me haces uno de la familia Vioque Trillo que son mis apellidos o regalamelo como regalo de bodas jajajaja. Un abrazo amigo.

    ResponderEliminar
    Respuestas
    1. Gracias Carlos. Me alegro de que te haya gustado y hayas refrescado estos temas. Para hacer la genealogía propia, lo primero que tienes que hacer es tirar de memoria familiar y preguntarle a tus padres, hermanos, tios y primos para hacer los primeros niveles del arbol. Lo importante es saber, nombre, dos apellidos, lugar de nacimiento y/o residencia y año (aunque sea aproximado) de nacimiento. También ayudan datos como profesión o año del matrimonio. A partir de ahí, cuando ya nadie se acuerde tienes que usar la información que haya en los archivos. Los archivos parroquiales en españa se remontan al siglo XVI, pero tienes que tener la suerte de que no se hayan perdido. El registro civil sólo llega hasta 1870 creo, pero está muy completo. Luego está el catastro de Ensenada que es del siglo XVIII. MUchas de estos recursos se pueden consultar en internet. Si tienes ánimo. Empieza a hacer algo, y a ver si podemos avanzar algo. Te puedo ayudar, o al menos intentar indicarte dónde puedes buscar, pero lo primero es que empiezes como te he dicho (memoria familiar).

      Bueno, un saludo y espero que por allí abajo haga mejor tiempo (hoy hemos amanecido con 10ºC y no tiene pinta de mejorar). Un abrazo, Armando

      Eliminar
  2. Ya se como iba, que ha sido un gran esfuerzo, y que solo tu ,y tu familia, saben las horas que has metido.
    Pero tiene su recompensa, y aqui a estas horas, estoy haciendo lo que nunca hubiera hecho de otra manera, conocer mejor el pueblo donde vivo, y lo que es mas difícil, aprender nuevas cosas sobre genealogía, que recuerdos ese tal Mendel.
    Ahora descansa, y con tiempo a preparar otra interesante entrada, pero que no sea sobre lo que vas a ver mañana 18/05/2013.
    Como siempre gracias y un saludo

    JOSE

    ResponderEliminar
    Respuestas
    1. Gracias Jose. Piensa que aprender algo de nuestro pueblo es aprender algo de los pueblos de alrededor, la comarca, el pais e incluso el mundo (ya sabes, el código genético es universal).
      De lo demas, sólo tengo que decir "Spain one point".

      Eliminar
  3. Muy bien esa introducción de genética y desde luego apropiada para el desarrollo del motivo del artículo.
    Según iba leyendo, pensaba para mi, a ver si nombra o no a Rosalind Franklin. Que malo soy a veces Armando.
    Por cierto en esas vegas por donde vives se sembraba en otros tiempos mucha borona, que luego se llevaba a molerla a molinos del Barbadun, lo digo para cuando toque hablar de Monsanto y sus "genes".

    Seguro que mi hermano mayor le suenan mucho esos apellidos y familias.

    Insisto en lo de una entrada muy bien trabajada y documentada.

    ResponderEliminar
  4. Gracias Alberto. Y me habré dejado a muchos en el tintero, anónimos y no anónimos. por lo menos Rosalind ha pasado a la historia como ejemplo de "olvidada" y otros no han llegado ni a eso, habiendo contribuido igualmente. El avance de la ciencia, esta lleno de miserias. Antes la ciencia era cosa de gentes de buena familia. Ahora la cosa está mas proletarizada, pero ahora como antes pasa que hay gente que firma artículos científicos sin ni siquiera haberlos leído (y por supuesto sin haber escrito una línea), sólo porque son jefes de.. o directivos de... Sin embargo, creo que poner como referentes a las clásicas figuras de la ciencia, ayuda a digerirla mejor y a entusiasmarse con ella, aunque esas personas, por lo demás fueran gente normal con sus miserias. Algunos, seguro que eran buenos tipos, trabajadores y geniales. Son como los vaqueros de las películas de John Ford, que aunque seguro que no existieron, su imagen idealizada nos sirve para darnos ánimos cuando nos toca cruzar el desierto de Mojave.

    Buena conexion entre los molinos del Barbadún y los transgénicos. Me temo que nunca molieron el afamado maíz Bt. No tengo muy claro que la ciencia (e incluso la tecnología) progrese más cuando se convierte en un negocio. Ese es el mantra de nuestro tiempo, que le vamos a hacer.

    Gracias de nuevo por tu visita y por el comentario

    ResponderEliminar
  5. Un artículo fabuloso, tanto la parte dedicada a la genética como la dedicada a la genealogía.Un auténtico regalo de Navidad que me ha hecho el blog Monografías Históricas de Portugalete al mencionarte en su valoración de este año 2013. Respecto a los rótulos cerámicos, recuerdo haber visto uno de Santurtzi en Cabieces, creo que ya no existe, pero también creo haber visto alguna foto. Si la encuentro te la enviaré.

    Urte berri on!!!

    ResponderEliminar
    Respuestas
    1. Muchas gracias. Siempre es una agradable sorpresa recibir comentarios de un post antiguo. Me alegro de que haya gustado. Siempre me ha gustado mezclar disciplinas y la genética y la genealogía casan perfectamente.

      Respecto a los rótulos, creo que es un patrimonio olvidado, y en muchos casos maltratado. Intento que sea un artículo vivo así que tda aportación será bien recibida (citaré su fuente, naturalmente).

      Un saludo, Zorionak eta Urte berri on 2014 !!!!!

      Eliminar
  6. Felicidades....un artículo fantástico....y eso que aun no he pasado de la introducción genética. Pero prometo que seguiré leyendo. Me ha servido para desempolvar un poco mis conocimientos, y me ha impresionado leer que mi ADN Mitocondrial me ha llegado por vía materna desde....uffff...me marea solo pensarlo. Muchas gracias, creo que me has ayudado a empezar a reconciliarme con una parte de mi.
    Un saludiño, y a falta de un mes....Zorionak eta berri 2016!!!!

    ResponderEliminar
  7. BUEN DIA:

    ALGUIEN ME PODRIA INVESTIGAR EL ARBOL GENEALOGICO DE EL APELLIDO PEDRIZA-CASUSO DE POBEÑA O SANTANDER, POR EL AÑO 1792?

    ResponderEliminar